Epidemiological features of the formation of hospital strains in urological departments. Microorganisms causing nosocomial infections Features of hospital strains

Owners of patent RU 2404254:

The invention relates to the identification of hospital strains of microorganisms in medical institutions and the implementation of appropriate anti-epidemic measures in them. The method includes determining the genotypic characteristics of the virulence of the strains under study and comparing them with the genotypic characteristics of the virulence of strains isolated in a medical institution from patients and surrounding objects. Strains are classified as hospital strains if the genotypic characteristics of the virulence of the strains under study correspond to the genotypic characteristics of the virulence of at least one of the strains isolated in a medical institution from patients and surrounding objects. Using the method simplifies the identification of hospital strains and reduces the time for identifying hospital strains. 1 table

The invention relates to the field of medicine, namely to epidemiology, and can be used to detect the circulation of hospital strains and to carry out anti-epidemic measures in medical institutions.

The relevance of the problem of nosocomial infections is determined by their wide distribution in medical institutions of various profiles and the significant damage these diseases cause to public health.

To identify the circulation of hospital strains in microbiological practice, epidemiological marking methods are used, the essence of which is that isolated cultures are identified to genus and species, and then intraspecific identification is carried out in order to establish biovar, serovar, ecovar, resistance to antibacterial substances, and genotype. The proposed methods require significant material costs and a long time for laboratory research.

There is a known method for identifying hospital strains by determining the sensitivity of strains to antibiotics, compiling antibiograms and comparing antibiograms of bacterial cultures isolated from patients and from the environment.

The disadvantage of the proposed method is the lack of specificity due to the widespread prevalence of antibiotic resistance, including in non-hospital strains of pathogens, as well as the difficulty of interpreting the results due to the high degree of heterogeneity of the hospital population of the pathogen in terms of antibiotic resistance.

There is a known method for identifying hospital strains, which includes determining the biorhythms of bacteria isolated from patients and comparing the resulting biorhythms with the biorhythms of reference non-hospital strains of a given type of bacteria. Biorhythms are analyzed according to the period of bacterial reproductive activity, rhythm frequency, mesor, amplitude of bacterial reproductive activity and acrophase. If the biorhythms of the isolated bacterial strain do not coincide with the biorhythms of the reference non-hospital strain, the isolated strain is classified as hospital-acquired.

The disadvantages of this method include the difficulty of interpreting the results, low specificity due to the significant diversity of hospital and non-hospital genotypes with different biorhythms. In addition, when implementing this method, round-the-clock work of a microbiologist is required, taking measurements after 8, 12, and 24 hours from the start of the research.

As a prototype based on the closest technical essence, we have chosen a method for diagnosing a hospital strain of Pseudomonas aeruginosa aeruginosa, which includes determining the sensitivity of the strain to antibiotics, its phagotype and serotype, resistance to disinfectants, plasmid profile, adhesion coefficient to epithelial cells, the strain PSEUDOMONAS AERUGIOSA is diagnosed as hospitalized in the absence of sensitivity to nine or more antibiotics, the same phagoserotype, resistance to five disinfectants, a similar plasmid profile and an adhesion coefficient of 15±0.2 or more.

The disadvantages of the method adopted as a prototype include the fact that the method is labor-intensive and time-consuming, as it requires the determination of many characteristics of the strains under study; it takes 10-15 days to obtain the final result of the study. The implementation of the method also requires significant material costs.

The technical result of the invention is to simplify the method for identifying hospital strains and reduce the time it takes.

This technical result is achieved by determining the genotypic characteristics of the virulence of the strains under study and comparing them with the genotypic characteristics of the virulence of strains isolated in a medical institution from patients and surrounding objects. Strains are classified as hospital strains if the genotypic characteristics of the virulence of the strains under study correspond to the genotypic characteristics of the virulence of at least one of the strains isolated in a medical institution from patients and surrounding objects.

The proposed method is carried out as follows.

Species identification of the isolated culture is carried out, DNA is isolated and the presence of nucleotide sequences corresponding to gene regions of pathogenicity factors most typical for clinically significant isolates of a given species is determined by polymerase chain reaction or any other express method.

Based on the presence of certain genes, the genotypic characteristics of virulence or pathovars of the studied strains are determined and compared with the genotypic characteristics of virulence or pathovars of strains isolated in a medical institution from patients and surrounding objects and having a presumed epidemiological connection with the strains being studied. A strain is classified as a hospital strain if the genotypic characteristics of the virulence of the strains under study correspond to the genotypic characteristics of the virulence of at least one of the strains isolated from patients and surrounding objects in a medical institution.

Distinctive essential features of the proposed method are:

Determination of genotypic characteristics of virulence of the studied strains and their comparison with genotypic characteristics of virulence of strains isolated in a medical institution from patients and surrounding objects;

Classification of a strain as a hospital strain if the genotypic characteristics of the virulence of the studied strains correspond to the genotypic characteristics of the virulence of at least one of the strains isolated from patients and surrounding objects in a medical institution.

Cause-and-effect relationship between distinctive essential features and the achieved result

The choice of these genotypic characteristics as the main distinguishing features of the claimed invention is based on the theoretical position substantiated by the authors that virulence is the main characteristic of the hospital strain. For example, an increase in the level of virulence was noted during the formation of a hospital strain of Pseudomonas aeruginosa in a urological hospital, Serratia marcesens in the neonatal intensive care unit. However, other biological characteristics of hospital strains, such as antibiotic resistance, are secondary. It has been shown, in particular, that multiple resistance to antibacterial drugs can be equally characteristic of both hospital and non-hospital strains of enterococci. Thus, from our point of view, methods for identifying hospital strains based on the determination of antibiograms are not sufficiently specific and require mandatory confirmation using other methods of intraspecific typing. At the same time, it is known that hospital populations of pathogens of nosocomial infections differ from non-hospital populations by containing a larger number of genes of pathogenicity factors that cause increased virulence. In this case, epidemiologically related cultures will have the same set of pathogenicity factors, representing one strain. This circumstance makes it possible to use the presence of genes for pathogenicity factors (at least one, since strains that do not have them have no clinical and epidemic significance) and their combination (i.e., genotypic characteristics of virulence) as a distinctive feature of a hospital strain, provided that other strains isolated in a medical institution have similar genotypic characteristics, i.e. there is evidence of their epidemiological connection.

Thus, the use of our proposed method allows us to quickly identify the main inherent properties of a hospital strain (virulence and the genetic determinants that determine it) and identify the hospital strain based on the presence of these properties.

The set of distinctive essential features is new and allows, unlike the prototype, to simplify the method of identifying hospital strains and reduce the time of its implementation.

Examples of using the method

During epidemiological observation in a gynecological hospital, the genetic characteristics of Enterococcus spp. strains were determined. according to the claimed method using polymerase chain reaction (PCR) for 5 virulence genes - gelE, sprE, fsrB, esp and asal. To isolate DNA, enterococcal strains were grown in tryptose soy broth (BioMerieux), after which DNA was isolated using express PCR.

PCR was carried out starting with preliminary incubation of samples at 94°C for 2 minutes, and then for 30 cycles under the following conditions: denaturation (94°C) - 30 sec, annealing (47°C-65°C, depending on G-C composition of primers) - 60 sec, synthesis (72°C) - 60 sec, final synthesis 10 min at 72°C. The primers given in the table were used for amplification. The experiment was performed on an MJ Research instrument.

PCR results were assessed after electrophoresis in 1% agarose gel under ultraviolet light.

During the epidemiological observation in the gynecological hospital, it was revealed that E. faecium No. 429 was isolated from patient L., who was admitted on July 9, 2005 with a diagnosis of metroendometritis (case history No. 25230), on the fifth day of her stay in the department. Based on the determination of virulence genes, this strain was classified as genotype 2 (presence of the esp gene in the absence of the gelE, sprE, fsrB, asal genes). On the same day, this pathogen of the corresponding genotype was isolated from glove washes (strain 138 vs). An epidemiological examination revealed that on July 11, 2005, during examination of patient L., strain No. 421, similar in genotypic characteristics to the above strains, was isolated from the posterior vaginal vault and cervical canal.

In this case, the transmission factor could have been gloves considered sterile, taken for examination from a common bag that had already been opened.

Thus, cultures No. 421, 429 and 138 bc had the same genotypic characteristics, the esp pathogenicity factor gene, and had an obvious epidemiological connection; Based on the above characteristics, they were classified as a hospital strain.

In the Department of Purulent Osteology, epidemiological surveillance of nosocomial infections caused by methicillin-resistant strains of Staphylococcus aureus (MRSA) was carried out. In October 2008, MRSA with genotype 1 (presence of the sea gene, in the absence of the seb, sec, pvl, tst genes) was identified in four hospital patients. Due to the fact that the epidemic spread of the hospital strain of MRSA in the hospital was assumed, it was decided to conduct a bacteriological examination of the hospital environment in order to identify factors for the transmission of this strain. As a result of this examination, 4 cultures of staphylococcus were isolated: 139 VS (from the washout from the handle of the dressing table), 140 VS (from the washout from the handle of the tap in the dressing room), 148 VS (from the hands of nurse A.N.), 1a (from air dressing). The inventive method was used to classify these cultures as a hospital strain. Determination of virulence genes (enterotoxins A, B, C, toxic shock gene and Panton-Vallentyne toxin gene) was carried out according to the method of M. Mehrortra and Lina G

As a result of the studies, cultures 139 vs. and 140 vs. were assigned to genotype 1 (presence of the sea gene, in the absence of the seb, sec, pvl, tst genes), culture 148 vs. was assigned to genotype 2 (presence of the sea, seb genes, in the absence of the genes sec, pvl, tst), and when studying culture 1a, it turned out that it does not contain the studied genes of pathogenicity factors. Thus, when comparing the genetic characteristics of the studied cultures with the genetic characteristics of strains previously detected in the hospital, cultures 139 vs. and 140 vs. were classified as a hospital strain, while cultures 148 vs. and 1a were not classified as hospital strains.

The inventive method was tested in organizing epidemiological surveillance of nosocomial infections in hospitals in St. Petersburg (gynecological department of the Mariinsky Hospital, department of purulent osteology of the Peter the Great Hospital, hospital of the city center for the prevention of AIDS and infectious diseases). A total of 105 strains of enterococci and 61 strains of Staphylococcus aureus were studied. In the first two hospitals, testing of the proposed method made it possible to identify the formation of hospital strains of enterococci and Staphylococcus aureus. Due to the fact that the traditionally used method of classifying cultures as a hospital strain, based on determining the antibiogram, has insufficient specificity, the epidemiological marking method was used to verify the correctness of classifying the studied cultures as a hospital strain. To determine whether the isolated cultures belong to one strain (clonal type), a combination of several intraspecific typing methods, which are independent of each other, was used (phagotype and antibiogram for enterococci, typing by pulsed-field DNA electrophoresis, spa-sequencestip and antibiogram for staphylococci), and a surveillance method was used to prove that the strain caused associated hospital cases. The use of a combination of intraspecific typing methods in comparison with epidemiological data allows for reliable identification of the hospital strain. A total of 38 microbial cultures were tested using the proposed method and comparison method. In all cases, the use of this methodological technique made it possible to confirm the correctness of classifying the studied cultures as a hospital strain.

Thus, the proposed method makes it possible to identify hospital strains.

In contrast to the method chosen as a prototype, the inventive method for identifying hospital strains can significantly reduce the time spent on identifying a hospital strain.

According to our observations, the time required to identify 5 genes of pathogenicity factors in 10 bacterial strains ranges from 7 to 12 hours (from the moment of obtaining a pure culture of the microorganism), thus, the process of classifying the studied strain as a hospital strain is no more than two working days, in contrast to 10 -15 days when identifying a hospital strain using the method chosen as a prototype.

To perform this method, unlike the prototype, does not require highly qualified medical personnel, which requires mastery of complex molecular genetic (isolation and restriction of plasmids) and microbiological (determining the adhesion of a microorganism to the epithelium) techniques. In addition, the process of identifying genes using the PCR method, in contrast to the characteristics determined by the method chosen as a prototype, can be partially or fully automated using robotics, which significantly reduces time and labor costs.

The features of the proposed method also include the ease of interpretation of the results, since the classification of the studied culture as a hospital strain is made on the basis of only one criterion - the correspondence of the genotypic characteristics of the virulence of the studied strain with the genotypic characteristics of the virulence of at least one of the strains isolated from patients and surrounding objects in treatment and prophylactic institution.

Thus, the inventive method makes it possible to simplify the identification of hospital strains and reduce the time of the method.

Literature

1. Semina N.A. Nosocomial infections as a biosafety problem. /N.A.Semina. //Bulletin of the Russian Academy of Medical Sciences. - 2002. - No. 10. - P.48-50.

2. Zueva L.P., Yafaev R.Kh. Epidemiology: Textbook. - St. Petersburg, 2006. - 752 p.

3. Pfaller M.A., Cormican M.J. Microbiological aspects of the problem of nosocomial infections: the role of the clinical laboratory. In the book. R.P. Wenzel. Nosocomial infections. M. 2004. - 840 p.

4. RU 2245922, 02/10/2005.

5. RU 2285258, 10.10.2006.

6. RU 2110579, 05/10/1998.

7. Yafaev R.Kh., Zueva L.P. Epidemiology of nosocomial infection. L.: Medicine, 1989. - 168 p.

8. Lyubimova A.V., Zueva L.P., Eremin S.R., Khrustaleva N.M., Lyubimenko V.A., Pulin A.M., Shulaeva S.V., Leshchinskaya V.N. Successes in implementing an infection control system in neonatal intensive care units. In the book: L.P. Zueva. Experience in implementing infection control in health care institutions. SPb. 2003, pp.91-129.

9. Yafaev R.Kh., Kolodzhieva V.V., Ermolenko E.I., Suvorov A.N. Enterococcal infections of the urogenital tract in hospital and clinic settings. Hospital-replacing technologies. Outpatient surgery. No. 3 (23), 2006

10. Becker, K., A. W. Friedrich, G. Lubritz, M. Weilert, G. Peters, and C. von Eiff. 2003. Prevalence of genes encoding pyrogenic toxin superantigens and exfoliative toxins among strains of Staphylococcus aureus isolated from blood and nasal specimens. J. Clin. Microbiol. 41:1434–1439.

11. Schmidt, H. and Hensel, M. (2004) Pathogenicity islands in bacterial pathogenesis. Clin. Microbiol. Rev., 17, 14-56. 12, 656-664.

12. Mehrotra M., Wang G. and Johnson W.M. Multiplex PCR for detection of genes for Staphylococcus aureus enterotoxins, exfoliative toxins, toxic shock syndrome toxin 1, and methicillin resistance. // J. Clin. Microbiol. - 2000, 38, 3: 1032-1035.

13. Lina G., Piemont Y., et al. Involvement of Panton-Valentine leukocidin-producing Staphylococcus aureus in primary skin infections and pneumonia. Clin Infect Dis 1999; 29:1128-1132.

14. Shaginyan I.A. The role and place of molecular genetic methods in the epidemiological analysis of nosocomial infections. Wedge. microbiology and antimicrobial chemotherapy." 2000. - T2, No. 3, pp. 82-95.

Genes and primers	Nucleotide sequence 5′-3′	Expected size of amplification product n.p.
gelE	gelE 1	ACCCCGTATCATTGGTTT	419
gelE 2	ACGCATTGCTTTTCCATC
esp	esp 1	TTGCTAATGCTAGTCCACGACC	933
esp 2	GCGTCAACACTTGCATTGCCGAA
sprE	spr 1	GCGTCAATCGGAAGAATCAT	233
spr 2	CGGGGAAAAAGCTACATCAA
fsrB	fsr 1	TTTATTGGTATGCGCCACAA	316
fsr 2	TCATCAGACCTTGGATGACG
asal	asa 1	CCAGCCAACTATGGCGGAATC	529
asa 2	CCTGTCGCAAGATCGACTGTA

A method for identifying hospital strains, including determining the genotype of the strain, characterized in that the genotypic characteristics of the virulence of the studied strains are determined and compared with the genotypic characteristics of the virulence of strains isolated in a medical institution, from patients and surrounding objects, the strains are classified as hospital strains if the genotypic characteristics correspond virulence of the studied strains; genotypic characteristics of the virulence of at least one of the strains isolated in a medical institution, from patients and surrounding objects.

Relevance and significance of the problem

Nosocomial infections (HAIs, synonyms: hospital-acquired, nosocomial, hospital-acquired infections) represent one of the most pressing health problems in all countries of the world. The socio-economic damage they cause is enormous and difficult to determine. Paradoxically, despite the enormous achievements in the field of diagnostic and treatment technologies, in particular inpatient treatment technologies, the problem of nosocomial infections remains one of the most acute and is gaining increasing medical and social significance. According to domestic and foreign researchers, nosocomial infections develop in 5-20% of hospitalized patients.

The origins of nosocomial infections go back to the distant past. Infectious diseases associated with various medical interventions and manipulations arose after the appearance of people involved in treatment, and infectious diseases in hospitals - from the time of the formation of medical institutions and the principles of hospital treatment. Now we can only guess the damage caused to humanity by nosocomial infections during this time. Suffice it to recall the words of N.I. Pirogova: “If I look back at the cemeteries where those infected in hospitals are buried, I don’t know what to be more surprised at: the stoicism of surgeons or the trust that hospitals continue to enjoy from the government and society. Can we expect true progress until doctors and the government take a new path and begin to jointly destroy the sources of hospital miasma?

In 1867, Joseph Lister first suggested that wound infections, widespread in surgical wards and leading to high mortality, were caused by living agents. Later, Lister connected the idea of ​​exogenous infection with the research of L. Pasteur and developed a harmonious, theoretically based system of measures for the prevention of wound infection (antiseptics with elements of asepsis). He emphasized the importance of destroying microorganisms on environmental objects in contact with the wound and protecting it from air. Lister's teaching laid the foundation for the prevention of wound infection.

In the 50-60s of the 20th century, the urgency of the problem of combating nosocomial infections was first felt by economically developed countries, where, against the backdrop of successes achieved in the fight against many infectious and somatic diseases, they noted an increase in the incidence of nosocomial infections. The development of hospital networks and the increase in the volume of hospital care in developing countries have led to an increase in the incidence of nosocomial infections, which have become a global health problem.

The growth of nosocomial infections in modern conditions is generated by a complex of the following main factors.

The creation of large hospital complexes with a unique ecology: a high population density, represented mainly by weakened contingents (patients) and medical personnel. Constant and close communication between patients, the isolation of the environment (patient rooms, rooms for diagnostics and treatment procedures), the originality of its microflora, represented mainly by antibiotic-resistant strains of opportunistic microorganisms.

Formation of a powerful artificial (artificial) mechanism for the transmission of infectious agents caused by invasive therapeutic and diagnostic procedures. The increasing use of sophisticated technology for diagnosis and treatment, requiring special sterilization methods, is essential.

Activation of natural mechanisms of transmission of infectious pathogens

diseases, especially airborne and household contact diseases, in conditions of close communication between patients and medical personnel in medical institutions.

A large number of sources of infection in the form of patients admitted to the hospital with unrecognized infectious diseases, as well as persons with nosocomial infections complicating the underlying disease in the hospital. An important role belongs to medical personnel (carriers, patients with erased forms).

Widespread, sometimes uncontrolled use of antimicrobial drugs. Not always a sufficiently thought-out strategy and tactics for prescribing them for the treatment and prevention of diseases contributes to the emergence of drug resistance in microorganisms.

Formation of hospital strains of microorganisms characterized by high resistance to drugs and adverse environmental factors (ultraviolet irradiation, drying, the action of disinfectants).

Increasing the number of risk groups formed by patients being nursed

mi and curable thanks to the achievements of modern medicine.

A general decrease in the resistance of the organism in the population due to its evolution

no preparation for rapidly changing living conditions due to rapid scientific and technological progress and its shadow sides - environmental pollution, environmental crisis, changes in living conditions of the population (physical inactivity, stress, adverse effects on the body of noise, vibration, magnetic fields, etc.) .

Slow psychological restructuring of some clinicians who still consider many nosocomial infections (pneumonia, inflammatory diseases of the skin, subcutaneous tissue, etc.) as a non-infectious pathology and untimely or do not carry out the necessary preventive and anti-epidemic measures.

In recent years, there has been an increase in the number of people with various disorders of the immune system; For them, nosocomial infections become the main cause of morbidity and mortality.

The addition of nosocomial infections cancels out the efforts spent on performing complex operations or caring for newborns. Layering on the underlying disease, nosocomial infections have a great impact on the condition of the body: they lead to prolongation of treatment, chronicity of the process, and in the most severe cases, to the death of the patient.

For a long time, only diseases arising as a result of infection in a hospital were classified as nosocomial infections. It is this part of the nosocomial infection, of course, the most noticeable and significant, that primarily attracted the attention of the public and medical workers. Today, according to the definition, an nosocomial infection includes “any clinically recognizable infectious disease that affects a patient as a result of his admission to a hospital or seeking medical care or hospital employees as a result of their work in this institution, regardless of the appearance of symptoms of the disease during their stay in hospital or after discharge."

From this definition it follows that the concept of nosocomial infections includes both diseases of patients who received medical care in hospitals and clinics, medical units, health centers, at home, etc., as well as cases of infection of medical personnel in the course of their professional activities.

This problem is causing increasing concern in Russia. Every year, according to far from complete data, 50-60 thousand cases of nosocomial infections are registered in the Russian Federation. At the same time, the registered incidence rate of nosocomial infections in Russia does not fully reflect the true state of affairs.

The problem of nosocomial infections is studied and considered in various aspects, including economic and social. The economic damage caused by nosocomial infections consists of direct and additional costs associated with an increase in the patient’s length of stay in the hospital, laboratory examination, treatment (immunotherapy, etc.). According to American authors, the cost of an additional hospital stay due to nosocomial infections ranges annually from 5-10 billion US dollars, in Hungary - 100-180 million forints, in Bulgaria - 57 million leva, in Germany - 800 thousand marks.

The social aspect of damage concerns harm to the health of the victim, including disability in some nosological forms, as well as increased mortality of patients. According to the data, the mortality rate among those hospitalized with nosocomial infections was 10 times higher than that of persons without infection.

Features of the epidemic process of purulent-septic infection:

Permanent course involving a large number of patients and medical personnel;

Formation of hospital strains. The term hospital strain of microbe is widely used in the literature, but there is no common understanding of this concept. Some believe that a hospital strain is one that is isolated from patients, regardless of its properties.

Most often, hospital strains refer to cultures that are isolated from patients in a hospital and are characterized by pronounced resistance to a certain number of antibiotics, i.e., according to this understanding, a hospital strain is the result of the selective action of antibiotics. It is precisely this understanding that is included in the first definition of hospital strains available in the literature, given by V.D. Belyakov and co-authors.

Bacterial strains isolated from patients with nosocomial infections are usually more virulent and have multiple chemoresistance. The widespread use of antibiotics for therapeutic and prophylactic purposes only partially suppresses the growth of resistant bacteria and leads to the selection of resistant strains. A vicious circle is formed - emerging nosocomial infections require the use of highly active antibiotics, which in turn contribute to the emergence of more resistant microorganisms. An equally important factor should be considered the development of dysbiosis that occurs during antibiotic therapy and leads to the colonization of organs and tissues by opportunistic microorganisms Tab. 1. Factors predisposing to the development of infections.

External factors are specific to any hospital Microflora of the patient Invasive medical procedures performed in the hospital Medical personnel Equipment and instruments Skin Long-term catheterization of veins and bladder Permanent carriage of pathogenic microorganisms Food products Gastrointestinal tract Intubation Temporary carriage of pathogenic microorganisms Air Genitourinary system Surgical violation of the integrity of anatomical barriers Sick or infected employees Doctor medicinal agentRespiratory tractEndoscopyTable 2. The main causative agents of nosocomial infections Bacteria Viruses Protozoa Fungi Staphylococcus and HBV, HCV, HDV Pneumocystis Candida Streptococci HIV Aspirgillus Pseudomonas aeruginosa Influenza viruses and other acute respiratory viral infections Cryptosporidium Etorobacter Measles Escherichia virus Rubella virus Salmonella Mumps virus Shigella Yersinia Rotavirus Mystery Cambilobacteria Enterobacteria Legionella Herpes virus Clostridia Cytomegalovirus Non-spore-forming anaerobic bacteria Mycoplasma Chlomydia Mycobacteria Bordetella Tab. 3. Main sources of hospital infections SourceRole of the source in the spreadPatientsThe main source role in the spread varies for different nosological forms and in different hospitalsCarriersIs of great importance in the spread of staphylococcal infections, hepatitis B, C and D, salmonellosis, shigellosis, etc. Medical workersMore often asymptomatic carriers of predominantly hospital strains play an important role role in the spread of pathogens of respiratory infections pneumocytosis, pneumonia, bronchitis and ARVI. The frequency of carriage can reach 50. Persons involved in caring for patients are not of great importance; they can be carriers of streptococci, staphylococci, entero- and cambilobacteria, causative agents of sexually transmitted diseases, rotaviruses, cytomegaloviruses and other herpetoviruses, causative agents of hepatitis and diphtheria, pneumocystis. Visitors visiting patients The role is very limited; I may be carriers of staphylococci, enterobacteria, or suffer from acute respiratory viral infections. Table 4. Transmission of infection to and from hospital personnel Diseases Route of transmission From patient to medical personnel From medical personnel to patient AIDS Varicella disseminated herpes zoster High High Localized herpes zoster Low Low Viral conjunctivitis High High Cytomegalovirus infection Low - Hepatitis A Low Rare Hepatitis B Low kiRareHepatitis neither A nor BLow-Herpes simplexLowRare InfluenzaModerateModerateMeaslesHighHigh Meningococcal infectionRare-MumpsModerateModerateWhooping coughModerate ModerateRespiratory syncytial virusModerateModerateRotavirusModerateModerateRubellaModerateModerateSalm onellaShigellaLowLowScabiesLowLowS. aureus-RarelyStreptococcus, group A-RarelySyphilisLow-TuberculosisFrom low to highFrom low to high 3 Objects, materials and methods of research Objects of research during bacteriological control are - air - various environmental objects - surgical instruments - syringes, needles - multiple blood transfusion systems use of probes, catheters, bougies, rubber gloves and other products made of rubber and plastic compounds - surgical suture material prepared for use - surgeons' hands and the skin of the surgical field. The study of sanitary and hygienic conditions includes determining the air temperature in the main rooms of hospital wards, treatment rooms, dressing rooms, operating rooms and other rooms using mercury and alcohol thermometers, relative humidity is measured using an Assmann psychrometer, air speed with a ball catheterometer, illumination with a Yu-16 luximeter. Measurements are carried out using generally accepted methods in accordance with modern regulatory documents.

The concept of microbiological control of a hospital includes bacteriological examination of environmental objects for the presence of pathogenic microorganisms that can cause nosocomial infections.

Planned bacteriological control is based on the determination of general microbial contamination and the identification of sanitary-indicative microorganisms: staphylococci, Escherichia coli bacteria, etc. When conducting bacteriological studies, the set of premises in which sampling is carried out and the list of environmental items subject to examination are determined in accordance with the order Ministry of Health of the USSR 720 dated July 31, 1978 3.1

End of work -

This topic belongs to the section:

Sanitary microbiological research and monitoring of nosocomial infections in medical institutions

Joining the main disease, V. and. worsens the course and prognosis of the disease. Problems of V. and. have acquired great relevance in connection with the emergence of so.. They easily spread among children and the weakened, especially the elderly, patients with reduced immunological..

If you need additional material on this topic, or you did not find what you were looking for, we recommend using the search in our database of works:

What will we do with the received material:

If this material was useful to you, you can save it to your page on social networks:

The pathogens of nosocomial infections circulating in hospitals gradually form the so-called hospital strains, i.e., strains most effectively adapted to the local characteristics of a particular department.

The main feature of hospital strains is increased virulence (in all cases this is the first and main feature of the hospital strain), as well as specific adaptation to the medicinal drugs used (antibiotics, antiseptics, disinfectants, etc.). Currently, a system has emerged in which a hospital strain is judged by its spectrum of antibiotic resistance.

Conditions in which opportunistic microorganisms are capable of causing disease, and features of the hospital environment that contribute to the implementation of these conditions

This is a convenient and accessible formation control system in practical conditions. hospital strain pathogens of nosocomial infections, since there is irrefutable evidence of the connection between the antibiotics used in the hospital and the resistance spectrum of pathogens. But it must be borne in mind that such strains turn out to be extremely dangerous not only because of resistance to therapeutic drugs, but also due to their increased (and sometimes significantly) virulence (they have a lower infectious dose, acquired additional pathogenicity factors, etc.) .d.).

Hospital strains as a result of stable circulation in a medical institution, they acquire additional intraspecific characteristics that allow epidemiologists to establish epidemiological connections between patients and determine the routes and factors of transmission.

Opportunistic microorganisms cause major part of nosocomial infections. In the domestic literature, the term “purulent-septic infections” (PSI) is often used to refer to hospital-acquired infections caused by UPM, although this term sometimes causes confusion among clinicians (purulent discharge does not always accompany the course of an infection caused by UPM). The reason for the dominance of opportunistic microorganisms in the etiological structure of nosocomial infections is that it is in hospital conditions that opportunistic microorganisms encounter the very conditions that ensure their ability to cause clinically significant diseases.

Nosocomial infections(Also hospital, nosocomial) - as defined by WHO, any clinically significant disease of microbial origin that affects a patient as a result of his hospitalization or visit to a medical institution for the purpose of treatment, or within 30 days after discharge from hospital (for example, wound infection), as well as hospital staff due to the implementation of their activities, regardless of whether symptoms of this disease appear or do not appear while these persons are in the hospital.

An infection is considered nosocomial if it first appears 48 hours or more after hospital stay, provided there are no clinical manifestations of these infections at the time of admission and the possibility of an incubation period has been excluded. In English, such infections are called nosocomial infections, from ancient Greek. νοσοκομείον - hospital (from νόσος - disease, κομέω - I care).

Hospital infections should be distinguished from the related concepts of iatrogenic and opportunistic infections, which are often confused with them.

Iatrogenic infections- infections caused by diagnostic or therapeutic procedures.

Opportunistic infections- infections that develop in patients with damaged immune defense mechanisms.

Story

From the time of the establishment of the first maternity hospital in the 17th century until the middle of the 19th century, puerperal fever was rampant in European maternity hospitals, during epidemics of which the mortality rate carried to the grave up to 27% of women in labor. It was possible to cope with puerperal fever only after its infectious etiology was established and aseptic and antiseptic methods were introduced in obstetrics.

Examples of hospital-acquired infections

• Ventilator-associated pneumonia (VAP)
• Tuberculosis
• Urinary tract infections
• Hospital pneumonia
• Gastroenteritis
• Staphylococcus aureus
• Methicillin-resistant Staphylococcus aureus(MRSA)
• Pseudomonas aeruginosa
• Acinetobacter baumannii
• Stenotrophomonas maltophilia
• Vancomycin-resistant enterococci
• Clostridium difficile

Epidemiology

In the United States, the Centers for Disease Control and Prevention estimates that approximately 1.7 million hospital-acquired infections caused by all types of microorganisms cause or are associated with 99,000 deaths annually.

In Europe, according to the results of hospital studies, mortality from nosocomial infections is 25,000 cases per year, of which two thirds are caused by gram-negative microorganisms.

In Russia, about 30 thousand cases are officially recorded annually, which indicates shortcomings in statistics. A study conducted in 32 emergency hospitals across the country found that hospital-acquired infections developed in 7.6 percent of patients treated in hospitals. If we consider that the approximate number of patients treated in hospitals in Russia is 31-32 million patients, then we should have 2 million 300 thousand cases of hospital infections per year.

Nosocomial agents can cause severe pneumonia, infections of the urinary tract, blood and other organs.

Nosocomial infections are characterized by their own epidemiological features that distinguish them from classical infections. These include: the uniqueness of the mechanisms and factors of transmission, the peculiarities of the course of epidemiological and infectious processes, the important role of medical personnel of healthcare facilities in the emergence, maintenance and spread of nosocomial infections.

Many types of infections are difficult to treat due to antibiotic resistance, which is gradually beginning to spread among gram-negative bacteria, which are dangerous for people in the community environment.

For an HAI to occur, the following must be present: links infectious process:

• source of infection (owner, patient, healthcare worker);
• pathogen (microorganism);
• transmission factors
• susceptible organism

Sources in most cases they serve:

• medical personnel;
• carriers of latent forms of infection;
• patients with acute, advanced or chronic forms of infectious diseases, including wound infections;

Hospital visitors are very rarely sources of nosocomial infections.

Transmission factors The most common sources are dust, water, food, equipment and medical instruments.

Leading ways of infection in the conditions of health-care facilities are contact-household, airborne and airborne-dust. The parenteral route is also possible (typical for hepatitis B, C, D, etc.)

Mechanisms of transmission : aerosol, fecal-oral, contact, hemocontact.

Contributing Factors

Factors in the hospital environment that contribute to the spread of nosocomial infections include:

• underestimation of the epidemic danger of nosocomial sources of infection and the risk of infection through contact with a patient;
• LPO overload;
• the presence of undetected carriers of nosocomial strains among medical staff and patients;
• violation by medical staff of the rules of asepsis and antiseptics, personal hygiene;
• untimely implementation of current and final disinfection, violation of the cleaning regime;
• insufficient equipment of health care facilities with disinfectants;
• violation of the disinfection and sterilization regime for medical instruments, devices, devices, etc.;
• outdated equipment;
• unsatisfactory condition of catering facilities and water supply;
• lack of filtration ventilation.

Risk group

Persons at increased risk of infection with nosocomial infections:

1. Sick:
   • without a fixed place of residence, migrating population,
   • with long-term untreated chronic somatic and infectious diseases,
   • unable to receive special medical care;
2. Persons who:
   • therapy that suppresses the immune system (irradiation, immunosuppressants) is prescribed;
   • Extensive surgical interventions are carried out followed by blood replacement therapy, program hemodialysis, infusion therapy;
3. Women in labor and newborns, especially premature and post-term;
4. Children with congenital developmental anomalies, birth trauma;
5. LPO medical staff.

Etiology

In total, there are more than 200 agents that can cause nosocomial infections. Before the advent of antibiotics, the main ones were streptococci and anaerobic bacilli. However, after the start of the clinical use of antibiotics, previously non-pathogenic (or opportunistic) microorganisms became the causative agents of the main nosocomial infections: St. aureus, St. epidermidis, St. saprophiticus, Escherichia coli, Enterococcus faecalis, Enterococcus durans, Klebsiella sp., Proteus mirabilis, Providencia spp, Acinetobacter, Citrobacter, Serratia marcescens.

It has also been established that nosocomial infection can be associated with the spread of rotavirus, cytomegalovirus infection, campylobacter, hepatitis B, C and D viruses, as well as HIV infection.

As a result of the circulation of microorganisms in the department, their natural selection and mutation occurs with the formation of the most resistant hospital strain, which is the direct cause of nosocomial infections.

Hospital strain - this is a microorganism that has changed in its genetic properties as a result of circulation in the department, as a result of mutations or gene transfer (plasmids) and has acquired some characteristic features that are unusual for the “wild” strain, allowing it to survive in a hospital setting.

The main features of the adaptation are resistance to one or more broad-spectrum antibiotics, resistance to environmental conditions, decreased sensitivity to antiseptics. Hospital strains are very diverse; each hospital or department may have its own characteristic strain with a unique set of biological properties.

Classification

1. Depending on the routes and factors of transmission, nosocomial infections are classified:
   • Airborne (aerosol)
   • Introductory nutritional
   • Contact and household
   • Contact-instrumental
   • Post-injection
   • Postoperative
   • Postpartum
   • Post-transfusion
   • Postendoscopic
   • Post-transplant
   • Postdialysis
   • Post-hemosorption
   • Post-traumatic infections
   • Other forms.
2. From the nature and duration of the flow:
   • Acute
   • Subacute
   • Chronic.
3. By severity:
   • Heavy
   • Medium-heavy
   • Mild forms of clinical course.
4. Depending on the extent of the infection:
   • Generalized infections: bacteremia (viremia, mycemia), septicemia, septicopyemia, toxic-septic infection (bacterial shock, etc.).
   • Localized infections
   • Infections of the skin and subcutaneous tissue (burns, operating rooms, traumatic wounds, post-injection abscesses, omphalitis, erysipelas, pyoderma, abscess and phlegmon of the subcutaneous tissue, paraproctitis, mastitis, dermatomycosis, etc.);
   • Respiratory infections (bronchitis, pneumonia, pulmonary abscess and gangrene, pleurisy, empyema, etc.);
   • Eye infections (conjunctivitis, keratitis, blepharitis, etc.);
   • ENT infections (otitis, sinusitis, rhinitis, mastoiditis, tonsillitis, laryngitis, pharyngitis, epiglottitis, etc.);
   • Dental infections (stomatitis, abscess, etc.);
   • Infections of the digestive system (gastroenterocolitis, enteritis, colitis, cholecystitis, hepatitis, peritonitis, peritoneal abscesses, etc.);
   • Urological infections (bacteriuria, pyelonephritis, cystitis, urethritis, etc.);
   • Infections of the reproductive system (salpingoophoritis, endometritis, etc.);
   • Bone and joint infections (osteomyelitis, joint or joint capsule infection, intervertebral disc infection);
   • Infections of the central nervous system (meningitis, brain abscess, ventriculitis, etc.);
   • Infections of the cardiovascular system (infections of arteries and veins, endocarditis, myocarditis, pericarditis, postoperative mediastinitis).

Prevention

Prevention of nosocomial infections is a complex and comprehensive process that must include three components:

• minimizing the possibility of introducing infection from the outside;
• preventing the spread of infection between patients within the institution;
• preventing the spread of infection outside the health care facility.

Treatment

Treatment of nosocomial infection

Ideally, an antimicrobial drug with a narrow spectrum of activity that acts on a specific microorganism isolated during a microbiological study should be prescribed. However, in practice, nosocomial infection, especially in the first days, is almost always treated empirically. The choice of the optimal antimicrobial therapy regimen depends on the predominant microflora in the department and the spectrum of its antibiotic resistance.

In order to reduce the antibiotic resistance of pathogens, regular rotation of antibacterial drugs should be practiced (when certain antibiotics are used in the department for empirical therapy for several months and then replaced by the next group).

Initial antimicrobial therapy

Nosocomial infections caused by gram-positive microorganisms are most effectively treated with vancomycin, while carbapenems (imipenem and meropenem), IV generation cephalosporins (cefepime, cefpirome) and modern aminoglycosides (amikacin) are most active against gram-negative bacteria.

From the above, one should not conclude that nosocomial infection can only be treated with the above-mentioned means. For example, pathogens of urinary tract infections remain highly sensitive to fluoroquinolones, third generation cephalosporins, etc.

But a serious nosocomial infection really requires the prescription of carbapenems or IV generation cephalosporins, since they have the widest spectrum of activity and act on polymicrobial flora, including multidrug-resistant gram-negative pathogens and many gram-positive microorganisms. The disadvantage of both groups of drugs is the lack of activity against methicillin-resistant staphylococci, so in severe cases they have to be combined with vancomycin.

In addition, all of these drugs do not act on fungal pathogens, the role of which in the development of nosocomial infections has increased significantly. Accordingly, in the presence of risk factors (for example, severe immunodeficiency), antifungal agents (fluconazole, etc.) should be prescribed.

In the 90s of the twentieth century, it was shown that the effectiveness of initial antibiotic therapy has a direct impact on the mortality of hospitalized patients. Mortality among patients who received ineffective initial therapy was higher than in patients who were prescribed antibiotics that are active against most pathogens. Moreover, in the case of inadequate initial therapy, even a subsequent change of antibiotic, taking into account microbiological data, did not lead to a decrease in mortality.

Thus, in case of severe nosocomial infections, the very concept of “reserve antibiotic” loses its meaning. The effectiveness of initial therapy is an important factor on which the prognosis for life depends.

Based on these data, it was developed de-escalation therapy concept. Its essence lies in the fact that as a starting empirical therapy, which begins immediately after diagnosis, a combination of antimicrobial agents is used that act on all possible infectious agents. For example, carbapenem or cefepime are combined with vancomycin (plus fluconazole) depending on the composition of the likely pathogens.

The arguments in favor of combination therapy are:

• wider range of activities;
• overcoming resistance, which is more likely to occur when using one drug;
• the presence of theoretical data on the synergism of certain agents.

Before using antibiotics, it is necessary to collect samples of biological fluids for microbiological testing. After receiving the results of a microbiological study and clinical assessment of the effectiveness of treatment, treatment adjustment is possible after 48-72 hours, for example, discontinuation of vancomycin if a gram-negative pathogen is identified. Theoretically, it is possible to change the entire combination to a drug with a narrower spectrum of action, although in a seriously ill patient who has responded to therapy, any doctor will prefer to leave the prescribed antibiotics.

The possibility of introducing de-escalation therapy depends on the effective operation of the microbiological service and the degree of confidence in its results. If the causative agent remains unknown, then this concept becomes meaningless and can lead to worse treatment results. The appropriateness of de-escalation therapy should be primarily discussed in patients with serious life-threatening infections (eg, ventilator-associated pneumonia, sepsis).

It should be borne in mind that the reverse approach (that is, escalation of therapy) in such situations may result in the death of the patient even before obtaining the result of a microbiological study.